Thermo Scientific™ T7 RNA Polymerase (20 U/µL), 5,000 Units
On demand
Brand origin :
United States
Expiry time :
On demand
Delivery time :
1 Week/s
Delivery cost :
On demand
Unit size :
5000U
Order number :
EP0111
Thermo Scientific™ T7 RNA Polymerase (20 U/µL) 5,000 Units
Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Features
- Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
Applications
- Synthesis of unlabeled and labeled RNA that can be used:
- For hybridization, in vitro RNA translation
- As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
- In studies of RNA secondary structure and RNA-protein interactions, RNA splicing
Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
MoreThere are no report
You May Also Like
Thermo Scientific™ FastAP Thermosensitive Alkaline Phosphatase (1 U/µL), 1000 Units
(Ex-work price)
$ 120
$ 120