Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
On demand
Order number :
SO115
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.
Primer sequence
5’-d(GAGCGGATAACAATTTCACACAGG)-3’
Related Products
- M13/pUC Reverse Sequencing Primer (-26), 17-mer: SO101
- M13/pUC Reverse Sequencing Primer (-20), 17-mer: SO100
- M13/pUC Reverse Sequencing Primer (-40), 17-mer: SO113
- M13/pUC Reverse Sequencing Primer (-46), 22-mer: SO114
There are no specifications
There are no report
You May Also Like
![](https://laboshop.ae/public/storage/files/6ce7b017-372c-41b7-bdea-b0753f420ae6.jpg)
Invitrogen™ Zero Blunt™ TOPO™ PCR Cloning Kit, with One Shot™ TOP10 Electrocomp™ E. coli, 25 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/RbDOXXuDDgLzajFbSnydDWloRHhpggqC7Oc9yJpn.jpg)
Invitrogen™ pShooter™ Mammalian Expression Vector (pCMV/myc/cyto)
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/bedd7c43-e088-4be9-a264-adf8646a3dd0.jpg)
Invitrogen™ TA Cloning™ Kit, Dual Promoter, with pCR™II Vector, without competent cells, 20 Reactions
(Ex-work price)
$ On demand
$ On demand