Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
On demand
Order number :
SO115
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.
Primer sequence
5’-d(GAGCGGATAACAATTTCACACAGG)-3’
Related Products
- M13/pUC Reverse Sequencing Primer (-26), 17-mer: SO101
- M13/pUC Reverse Sequencing Primer (-20), 17-mer: SO100
- M13/pUC Reverse Sequencing Primer (-40), 17-mer: SO113
- M13/pUC Reverse Sequencing Primer (-46), 22-mer: SO114
There are no specifications
There are no report
You May Also Like
Invitrogen™ TOPO™ TA Cloning™ Kit for Subcloning, with One Shot™ TOP10 chemically competent E. coli cells, 10 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ pcDNA™3.1/V5-His A, B, & C Mammalian Expression Vectors
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ TOPO™ TA Cloning™ Kit for Sequencing, without competent cells, 10 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ pMIR-REPORT™ miRNA Expression Reporter Vector System
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ TOPO™ XL-2 Complete PCR Cloning Kit, with One Shot™ OmniMAX™ 2 T1R Chemically Competent E. coli Cells, 10 Reactions
(Ex-work price)
$ On demand
$ On demand