Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
On demand
Order number :
SO118
Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.
Primer Sequence
5'-d (TAATACGACTCACTATAGGG)-3'
Related Products
- T3 promoter Sequencing Primer, 24-mer: SO120
- T3 promoter Sequencing Primer, 17-mer: SO119
- SP6 promoter Sequencing Primer, 18-mer: SO116
- SP6 promoter Sequencing Primer, 24-mer: SO117
There are no specifications
There are no report
You May Also Like
Invitrogen™ BLOCK-iT™ Lentiviral Pol II miR RNAi Expression System with EmGFP
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ TOPO™ TA Cloning™ Kit, Dual Promoter, with pCR™II-TOPO™ Vector and One Shot™ TOP10F' Chemically Competent E. coli, 25 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
Thermo Scientific™ CloneJET™ PCR Cloning Kit with DH10B Competent Cells, 20 Reactions
(Ex-work price)
$ On demand
$ On demand
