Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
On demand
Order number :
SO118
Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.
Primer Sequence
5'-d (TAATACGACTCACTATAGGG)-3'
Related Products
- T3 promoter Sequencing Primer, 24-mer: SO120
- T3 promoter Sequencing Primer, 17-mer: SO119
- SP6 promoter Sequencing Primer, 18-mer: SO116
- SP6 promoter Sequencing Primer, 24-mer: SO117
There are no specifications
There are no report
You May Also Like
![](https://laboshop.ae/public/storage/products/September2021/xwX9eIHdf2vC6CMCtyUX.jpg)
Invitrogen™ TOPO™ TA Cloning™ Kit, Dual Promoter, with pCR™II-TOPO™ Vector and One Shot™ TOP10 Electrocomp™ E. coli, 50 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/ycliFT0AQVguxC2gkLzwisRH8RDozy3epryQTu7g.jpg)
Invitrogen™ GeneArt™ Gibson Assembly EX Master Mix, 10 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/0HClzmLgXnsCQ5oasylxqLWGRxIInWa7fEXbPjSW.jpg)
Invitrogen™ Champion™ pET104 BioEase™ Gateway™ Biotinylation System
(Ex-work price)
$ On demand
$ On demand