Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer
On demand
Order number :
SO117
Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymearse promoter region and are supplied as 10 µM aqueous solutions.
Primer Sequence
5'-d (CATACGATTTAGGTGACACTATAG)-3'
Related Products
- T3 promoter Sequencing Primer, 24-mer: SO120
- T7 promoter Sequencing Primer, 20-mer: SO118
- SP6 promoter Sequencing Primer, 18-mer: SO116
- T7 promoter Sequencing Primer, 17-mer: SO119
There are no specifications
There are no report
You May Also Like
Invitrogen™ TA Cloning™ Kit, with pCR™2.1 Vector and One Shot™ TOP10 Chemically Competent E. coli, 20 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ pcDNA™6/myc-His A, B, & C Mammalian Expression Vectors
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ GeneArt™ Gibson Assembly HiFi Master Mix, 200 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
