Loader

Thermo Scientific™ T7 RNA Polymerase (20 U/µL) 5 x 5,000 Units

On demand
Brand origin : United States
Expiry time : On demand
Delivery time : 1 Week/s
Delivery cost : On demand
Unit size : 5 x 5000U
Order number : EP0112
(Ex-work price)
$ On demand

T7 RNA Polymerase (20 U/µL) 5 x 5,000 Units

 

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Features

  • Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)


Applications

  • Synthesis of unlabeled and labeled RNA that can be used:
  • For hybridization, in vitro RNA translation
  • As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
  • In studies of RNA secondary structure and RNA-protein interactions, RNA splicing


Consensus promoter sequence:

T7: TAATACGACTCACTATAGGGAGA

More  

There are no report


You May Also Like