Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
On demand
Order number :
SO501
Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Primer Sequence
5’-d(CGACTCACTATAGGGAGAGCGGC)-3’
Related Products
- pJET1.2 Reverse Sequencing Primer, 24-mer: SO511
There are no specifications
There are no report
You May Also Like
Invitrogen™ TA Cloning™ Kit, with pCR™2.1 Vector, without competent cells, 40 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ Zero Blunt™ TOPO™ PCR Cloning Kit for Sequencing, with One Shot™ Mach1™ T1 Phage-Resistant Chemically Competent E. coli
(Ex-work price)
$ On demand
$ On demand
On demand
Invitrogen™ TA Cloning™ Kit, with pCR™2.1 Vector and One Shot™ TOP10F' Chemically Competent E. coli, 40 Reactions
(Ex-work price)
$ On demand
$ On demand
