Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
On demand
Order number :
SO501
Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Primer Sequence
5’-d(CGACTCACTATAGGGAGAGCGGC)-3’
Related Products
- pJET1.2 Reverse Sequencing Primer, 24-mer: SO511
There are no specifications
There are no report
You May Also Like
![](https://laboshop.ae/public/storage/files/YVlE95QeqLDnuiKqL5dFQwZ39y2be7ypp4S09Ohe.jpg)
Invitrogen™ pENTR™/SD/D-TOPO™ Cloning Kit, with One Shot™ Mach1™-T1R Chemically Competent E. coli
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/T2OfaqaUAzsXfdTS8uKix5SKmc9Mx3ZC5qvKc4zh.png)
Invitrogen™ pCR™8/GW/TOPO™ TA Cloning Kit with One Shot™ Mach1™-T1R E. coli
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/products/September2021/1xws7HtBzHggO4QlZ3AL.jpg)
Invitrogen™ TOPO™ TA Cloning™ Kit for Subcloning, with One Shot™ Mach1™ T1 Phage-Resistant Chemically Competent E. coli
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/8a4497e2-4ec3-4e0c-8e48-677073638fee.jpg)
Invitrogen™ GeneArt™ Gibson Assembly HiFi Master Mix, 10 Reactions
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/xMfF51A7dpIuITvSz7pgaQoETwIuNtZkRI9DVY4j.jpg)
Invitrogen™ Champion™ pET302/NT-His and pET303/CT-His Vector Kit
(Ex-work price)
$ On demand
$ On demand
On demand
![](https://laboshop.ae/public/storage/files/q426vFwIDUmeIoF2hspCeA5CB1n3msTRKszzSZBX.jpg)
Invitrogen™ Champion™ pET300/NT-DEST and pET301/CT-DEST Gateway™ Vector Kit
(Ex-work price)
$ On demand
$ On demand